What is SVMicrO:
=========
  SVMicrO is a miRNA target prediction algorithm.


Authors:
=========
Hui Liu, Dong Yue and Yufei Huang


Get source code and prediction results:
=========
http://compgenomics.utsa.edu/svmicro.html


Building:
=========
  configure	# This detects the environment and prepares for make 
  make		# This creates the executable
  

Usage:
=========
./svmicro.pl [OPTION]
  -m		sequence of miRNA:
  -u		mRNA accession
  -M		turn off (mute) the display
  -h		display this help and exit


Example
=========
If you want to predict whether NM_024674 is a target of hsa-let-7a whose
sequence is ugagguaguagguuguauaguu, please run following command:

//	[SVMicrO]$ ./svmicro.pl -m ugagguaguagguuguauaguu -u NM_024674

The output will be like:
//	===================================== START ====================================
//	          ------------------------ Information -------------------------
//	mirna_seq: ugagguaguagguuguauaguu
//	gene_id: 79727	gene_sym: LIN28	mrna_acc: NM_024674
//	
//	Potential seed: 62
//	
//	          --------------- Potential Binding Site Table ---------------          
//	psite_pos	score	psite	6mer	7mer_A1	7mer_m1	7mer_m8	8mer	mirna_bind	site_bind	mirna_bind_start	mirna_bind_end	site_bind_start	site_bind_end	dg	dg5	dg3	ddg
//	912	1.7043913	GAGCAACUAUUUGGAGUGCACAGCCUAUUGAACUACCUCA	0	0	0	0	0	0	((((((((((((((((((((((	)))))).........))))))).....)))))))))	1	22	1	36	-25.50	-11.40	-14.10	-15.8962
//	1504	0.97015116	UUUCGUUUACACGCUGUGAGAUCACCGCAAACCUACCUUA	0	0	0	0	0	0	((((((((..(((..((((((	)))))).....)))......))))))))	1	21	1	28	-15.90	-9.20	-6.70	-8.193
//	
//	          -------------------- UTR Feature Table ---------------------          
//	utr_len	psite_dens	max_partial_psite_num	pos_site_dens	max_partial_pos_site_num	total_pos_score	psite_num	pos_site_num	top_score	psite_num_6mer	pos_site_num_6mer	top_score_6mer	psite_num_7mer_A1	pos_site_num_7mer_A1	top_score_7mer_A1	psite_num_7mer_m1	pos_site_num_7mer_m1	top_score_7mer_m1	psite_num_7mer_m8	pos_site_num_7mer_m8	top_score_7mer_m8	psite_num_8mer_A1	pos_site_num_8mer_A1	top_score_8mer_A1	psite_num_8mer_m1	pos_site_num_8mer_m1	top_score_8mer_m1	psite_num_other	pos_site_num_other	top_score_other
//	3270	0.018960244648318	6	0.000611620795107034	1	2.67454246	62	2	1.7043913	0	0	-3	0	0	-3	0	0	-3	0	0	-3	0	0	-3	0	0	-3	62	2	1.7043913
//	
//	          ---------------------- Target or Not -----------------------          
//	UTR score: 1.0297246
//	UTR is a target
//	===================================== END ======================================
The "Information" part contains the information of miRNA and mRNA. 
The "Potential seed" part shows the number of potential seeds which pass our seed binding rules.
The "Potential Binding Site Table" part shows the information of positive binding sites including:
  1) the position of the first NT (indexed from 3') of the site in the 3'UTR: psite_pos
  2) the output score of site-SVM for this site
  3) site sequence: psite
  4) seed type: 6mer, 7mer_A1, 7mer_m1, 7mer_m8, 8mer
  5) binding structrue: mirna_bind, site_bind, mirna_bind_start, mirna_bind_end, site_bind_start, site_bind_end
  6) some energy features: dg (free energy of site), dg5 (free energy of 5' region), dg3 (free energy of 3' region), ddg (accession energy)
The "UTR Feature Table" part shows the UTR feature used by UTR-SVM
The "Target or Not" part shows the UTR-SVM prediction score and the prediction result which is "UTR is a target" in this example. 
Note: If you want to get targets for a specific miRNA, we highly recommend make prediction in entire genomes and choose top 200~300 results as target instead of using "UTR is a target/UTR is not a target" in the "Target or Not" part.


Contact:
=========
Please send bug reports to: yufei.huang@utsa.edu or lhcumt@hotmail.com